base sequence of complementary DNA strands

[ixi]

One strand of a double helical DNA has the sequence (5')GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand.

Answer:
The complementary strand is
(5')GCGCAATATTTTGAGAAATATTGCGC(3')

-----------------------------------
(5')GCGCAATATTTCTCAAAATATTGCGC(3')
(5')GCGCAATATTTTGAGAAATATTGCGC(3')  --> Complementary strand


I don't understand this problem. I thought since the strand that's given is from 5' to 3', the complementary strand would be from 3' to 5'.  Also, I thought it was always A with T and C with C.

Help please

[sjb]

One strand of a double helical DNA has the sequence (5')GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand.

Answer:
The complementary strand is
(5')GCGCAATATTTTGAGAAATATTGCGC(3')

-----------------------------------
(5')GCGCAATATTTCTCAAAATATTGCGC(3')
(5')GCGCAATATTTTGAGAAATATTGCGC(3')  --> Complementary strand


I don't understand this problem. I thought since the strand that's given is from 5' to 3', the complementary strand would be from 3' to 5'.  Also, I thought it was always A with T and C with C.

Help please

In the first part, conventionally, you write NA strands from 5' to 3'. If you write the second strand 3' to 5' I think you see your pairing that you predict (A/T and G/C).

S

[ixi]

ooh i see. I wrote it from 3' to 5' but it's the same thing only reversed.

Thanks