Chemical Forums

Specialty Chemistry Forums => Biochemistry and Chemical Biology Forum => Topic started by: AussieKenDoll on May 10, 2019, 06:13:03 AM

Title: How to write the polypeptide resulting from the nucleotide sequence ?
Post by: AussieKenDoll on May 10, 2019, 06:13:03 AM

How to write the  polypeptide resulting from the nucleotide sequence given of TTGACAGGAGTGCACAGCCATCGC

Title: Re: How to write the polypeptide resulting from the nucleotide sequence ?
Post by: Babcock_Hall on May 10, 2019, 10:44:14 AM

Do you know what the genetic code is?