March 28, 2024, 02:02:53 PM
Forum Rules: Read This Before Posting


Topic: How to write the polypeptide resulting from the nucleotide sequence ?  (Read 1204 times)

0 Members and 1 Guest are viewing this topic.

Offline AussieKenDoll

  • Full Member
  • ****
  • Posts: 123
  • Mole Snacks: +0/-0
How to write the  polypeptide resulting from the nucleotide sequence given of TTGACAGGAGTGCACAGCCATCGC

Offline Babcock_Hall

  • Chemist
  • Sr. Member
  • *
  • Posts: 5594
  • Mole Snacks: +319/-22
Do you know what the genetic code is?

Sponsored Links