December 06, 2019, 11:15:32 PM
Forum Rules: Read This Before Posting

Topic: How to write the polypeptide resulting from the nucleotide sequence ?  (Read 272 times)

0 Members and 1 Guest are viewing this topic.

Offline AussieKenDoll

  • Regular Member
  • ***
  • Posts: 79
  • Mole Snacks: +0/-0
How to write the  polypeptide resulting from the nucleotide sequence given of TTGACAGGAGTGCACAGCCATCGC

Offline Babcock_Hall

  • Chemist
  • Sr. Member
  • *
  • Posts: 3906
  • Mole Snacks: +244/-16
Do you know what the genetic code is?

Sponsored Links