August 12, 2020, 08:39:07 AM
Forum Rules: Read This Before Posting


Topic: How to write the polypeptide resulting from the nucleotide sequence ?  (Read 444 times)

0 Members and 1 Guest are viewing this topic.

Online AussieKenDoll

  • Full Member
  • ****
  • Posts: 99
  • Mole Snacks: +0/-0
How to write the  polypeptide resulting from the nucleotide sequence given of TTGACAGGAGTGCACAGCCATCGC

Offline Babcock_Hall

  • Chemist
  • Sr. Member
  • *
  • Posts: 4231
  • Mole Snacks: +265/-17
Do you know what the genetic code is?

Sponsored Links