December 11, 2019, 08:55:30 PM
Forum Rules: Read This Before Posting


Topic: How to find the mutation of a nucleotide sequence?  (Read 338 times)

0 Members and 1 Guest are viewing this topic.

Offline AussieKenDoll

  • Regular Member
  • ***
  • Posts: 79
  • Mole Snacks: +0/-0
How to find the mutation of a nucleotide sequence?
« on: May 10, 2019, 06:19:39 AM »
TTGACAGGAGTGCACAGCCATCGC change to give TTGACAGGAGTGCACAGCCATCACGC, What is the mutation of TTGACAGGAGTGCACAGCCATCACGC?

Offline Babcock_Hall

  • Chemist
  • Sr. Member
  • *
  • Posts: 3909
  • Mole Snacks: +244/-16
Re: How to find the mutation of a nucleotide sequence?
« Reply #1 on: May 10, 2019, 10:46:06 AM »
A good place to start is to focus on where the two sequences are different.

Sponsored Links