October 27, 2020, 03:01:59 PM
Forum Rules: Read This Before Posting


Topic: How to find the mutation of a nucleotide sequence?  (Read 546 times)

0 Members and 1 Guest are viewing this topic.

Offline AussieKenDoll

  • Full Member
  • ****
  • Posts: 123
  • Mole Snacks: +0/-0
How to find the mutation of a nucleotide sequence?
« on: May 10, 2019, 06:19:39 AM »
TTGACAGGAGTGCACAGCCATCGC change to give TTGACAGGAGTGCACAGCCATCACGC, What is the mutation of TTGACAGGAGTGCACAGCCATCACGC?

Online Babcock_Hall

  • Chemist
  • Sr. Member
  • *
  • Posts: 4341
  • Mole Snacks: +267/-18
Re: How to find the mutation of a nucleotide sequence?
« Reply #1 on: May 10, 2019, 10:46:06 AM »
A good place to start is to focus on where the two sequences are different.

Sponsored Links