Specialty Chemistry Forums > Biochemistry and Chemical Biology Forum

How to find the mutation of a nucleotide sequence?

(1/1)

AussieKenDoll:
TTGACAGGAGTGCACAGCCATCGC change to give TTGACAGGAGTGCACAGCCATCACGC, What is the mutation of TTGACAGGAGTGCACAGCCATCACGC?

Babcock_Hall:
A good place to start is to focus on where the two sequences are different.

Navigation

[0] Message Index

Go to full version